Allele frequencies of Human Platelet Antigen 1 and Human Platelet Antigen 5 in the Maltese
HPA-1 and HPA-5 allele frequencies in the Maltese population
Abstract
Background: The human platelet antigen systems consist of antigenic polymorphisms that arise from single base pair substitutions leading to amino acid changes in platelet glycoproteins. These polymorphisms cause a variety of clinically significant conditions where platelet typing is essential for accurate diagnosis and subsequent treatment. The aim of this study was to determine the allele frequencies of Human Platelet Antigen-1 (HPA-1) and Human Platelet Antigen-5 (HPA-5) in the Maltese population and to compare these frequencies to those in other populations.
Methods: This study was conducted on a total of 508 population DNA samples. Polymerase chain reaction was used to amplify segments of DNA spanning the single nucleotide polymorphism of interest for both the HPA-1 and HPA-5 systems. A restriction enzyme digest was then used to differentiate between the genotypes. The data was analysed by gender and nationality.
Results and Conclusion: From this study it was determined that, for these two polymorphisms, the Maltese population is in Hardy-Weinberg equilibrium and that the local allele frequencies are similar to frequencies of geographically close populations. The frequencies of these two HPA systems are: HPA-1a/1a; 71.6%, HPA-1a/1b; 25.5%, HPA-1b/1b; 2.9%, HPA-5a/5a; 77.4%, HPA-5a/5b; 22.0% and HPA-5b/5b; 0.6%.
Platelet glycoprotein genes are polymorphic and these give rise to the platelet surface antigens which make up the Human Platelet Antigen (HPA) system. Twenty-nine HPA systems on 6 different glycoprotein complexes have been identified until now.1 The HPA system is an immunogenic system of alloantigens which, in the case of alloimmunization, may lead to a number of clinically significant conditions. Most HPA systems are biallelic including a high frequency antigen termed as ‘a’ and a lower frequency antigen termed as ‘b’.2 The HPA-5 polymorphism is situated in the GPIa part of the glycoprotein GPIaIIa,3 a collagen receptor on the surface of platelet membranes. It is caused by a single nucleotide polymorphism (SNP) on the gene that codes for the GPIa; the ITGA2 gene.4 The polymorphism causes a single base change of Guanine into Adenine, which leads to an amino acid change of Glutamic acid to Lysine located between the first and second divalent cation binding domain of the GPIa.5 On the other hand, the HPA-1 polymorphism is located on platelet GPIIa at amino acid residue 33.6 The Leucine (HPA-1a) to Proline (HPA-1b) SNP is positioned in exon 3 of the ITGB3 gene.7
Alloimmunization against such antigens can lead to 3 main clinical conditions which include Foetal and Neonatal Alloimmune Thrombocytopenia (FNAIT), Post Transfusion Purpura (PTP) and Refractoriness to Platelet Transfusion (RTP). Other conditions such as drug-induced and transplant-associated thrombocytopenia have also been reportedly associated.1 Recent studies have shown the association between some HPA systems and Hepatitis C virus (HCV) infection. HCV not only invades hepatocytes but also numerous other types of cells including B-cells and T-cells,8 macrophages and monocytes9 and platelets.10 Studies have also shown the relevance and possible association of HPA-5b and HCV carriers, where a higher allele frequency of HPA-5b was present in HCV carriers.11
FNAIT is a rare condition, with an incidence rate of 1 in 1000 to 1 in 2000 live births. 12-15 The condition is characterised by either severe thrombocytopenia in a newborn at birth or 7 days after birth, with a platelet count falling below 100,000 X 109/L, or foetal intracranial haemorrhage (ICH) with no other cause.16 FNAIT occurs during pregnancy when the maternal immune system detects foetal platelet specific antigens that are different from those present in the mother and in turn produces immunoglobulin G antibodies against these platelet antigens. These antibodies target and destroy foetal platelets,17 resulting in extravascular lysis of platelets18 and reduced production19. The most common HPA to cause FNAIT is alloimmunisation against HPA-1a12 causing 75 % of FNAIT cases followed by alloimmunisation to HPA-5b20 causing 16 % of all FNAIT cases.
PTP is an immuno-haematological disorder that may be observed in patients a week or several weeks after being transfused with a blood product containing platelets or platelet membranes.21 It has been reported in 1:50,000-100,000 transfusions22 and results in widespread purpura associated with fever, chills and bronchospasms around 7 - 10 days after receiving the transfusion. In general, such patients would have already been exposed to allogeneic platelets either through pregnancy or previous blood transfusions. The alloimmunisation causes the destruction of both the foreign alloantigenic platelets as well as the patient's own platelets resulting in a severe thrombocytopenia. RTP is a similar but milder condition where a low platelet count is noted after the patient has received an allogeneic random donor platelet transfusion.21
The population frequency of the HPA polymorphisms in the Maltese population are unknown and determining their frequencies would be useful for better detection, prevention and prompt treatment of all conditions described above, including identifying those who may be at risk to developing PTP and RTP.
MATERIALS AND METHODS
A total of 508 sequential cord blood samples were obtained from an anonymised Cord Blood Bank collection maintained by the Laboratory of Molecular Genetics (ethical approval 48/2002) and consisted of all samples from those born over a 2-month period in 2010. The only demographic data available included gender and whether the parents were Maltese or foreign. DNA was extracted from these samples using the Salting out technique.23 The quantity of the DNA was measured using the Nanodrop 2000c spectrophotometer and the DNA integrity was checked by agarose gel electrophoresis using a 0.7 % agarose gel. Each DNA sample was diluted to a concentration of 50 ng/µL.
In order to amplify the HPA-1 and the HPA-5 gene fragments of 193 bp and 256 bp respectively (Figure 1), specific primers were selected and polymerase chain reaction (PCR) was optimised (Table 1). The restriction enzyme NciI (NEB, UK) was used to digest HPA-1 PCR products (Figure 2A) using specific primers24. For HPA-5, the reverse primer had an altered nucleotide (A to T) 3 nucleotides from the 3’ end, in order to create a restriction enzyme cutting site for restriction enzyme DdeI25. The restriction enzyme DdeI (NEB, UK) cuts only HPA-5a PCR products but not HPA-5b PCR products (Figure 2B). The restriction enzyme digest products were separated by agarose gel electrophoresis and genotypes called based on the fragment pattern.
Primer Sequence | PCR Product (bp) | Annealing Temperature (°C) | ||
HPA-1 | F R | 5’ TCTTTGGGCTCCTGACTTAC 3’ 5’ CTGGGGACTGACTTGAGTGA 3’ | 193 | 52 |
HPA-5 | F R | 5’ CTCTCATGGAAAATGGCAGTA 3’ 5’ AGGAAGAGTCTACCTGTTTACTATCTAA 3' | 256 | 50 |
Statistical analysis included the calculation of allele and genotype frequencies for the Maltese population, as well as the χ2 test to determine if these were in Hardy-Weinberg equilibrium (HWE). Allele and genotype frequencies were calculated for the entire cord DNA collection as well as the subgroup with 2 Maltese parents. The ‘difference between 2 population proportions’ calculation was used to determine if there were any differences between frequencies of the subgroup with 2 Maltese parents (representing the traditional Maltese gene pool) and the collection as a whole (representing the current Maltese gene pool).
RESULTS
A total of 508 samples were tested to represent the Maltese population and these consisted of 51 % males and 49 % females. The HPA-1 and HPA-5 gene fragments were successfully amplified by PCR for these samples (Figure 1) and genotyped using NciI and DdeI respectively (Figure 2).
Genotype frequencies were calculated for each polymorphism (Table 2) and found to be in HWE using the Chi-squared test. The allele frequencies were determined as follows: 0.844 for HPA-1a, 0.156 for HPA-1b, 0.884 for HPA-5a and 0.116 for HPA-5b. From the genotype frequencies, the allele frequencies were calculated and compared to frequencies of other worldwide populations26-36 (Table 3). Statistical analysis using the χ2 test confirmed that there is no statistically significant difference between allele frequencies in Malta and the other countries for which data is available.
HPA system | aa genotype (%) | ab genotype (%) | bb genotype (%) | χ2 test P value |
HPA-1 | 71.6 | 25.5 | 2.9 | 0.486 |
HPA-5 | 77.4 | 22.0 | 0.6 | 0.113 |
Number of samples tested | Allele frequencies | |||||
Population | HPA-1 | HPA-5 | HPA-1a | HPA-1b | HPA-5a | HPA-5b |
Greek 21 | 58 | 58 | 0.67 | 0.33 | 0.85 | 0.15 |
Tunisian 22 | 90 | 90 | 0.75 | 0.25 | 0.78 | 0.22 |
Moroccan Berber 23 | 110 | 110 | 0.75 | 0.25 | 0.86 | 0.14 |
Slovenian 24 | 152 | 152 | 0.81 | 0.19 | 0.89 | 0.11 |
Swiss 25 | 500 | 500 | 0.81 | 0.19 | 0.93 | 0.07 |
Spanish 21, 26 | 727 | 454 | 0.81 | 0.19 | 0.88 | 0.12 |
Danish 21, 27 | 557 | 427 | 0.83 | 0.17 | 0.92 | 0.08 |
German 21, 28 | 1583 | 1643 | 0.84 | 0.16 | 0.92 | 0.08 |
Maltese | 489 | 492 | 0.84 | 0.16 | 0.88 | 0.12 |
French 21 | 800 | 6192 | 0.85 | 0.15 | 0.87 | 0.13 |
Italian 21 | 144 | 144 | 0.85 | 0.15 | 0.90 | 0.10 |
Irish 21 | 250 | 250 | 0.88 | 0.12 | 0.91 | 0.09 |
African 29 | 6382 | 922 | 0.89 | 0.11 | 0.84 | 0.16 |
Congolese 30 | 125 | 125 | 0.90 | 0.10 | 0.73 | 0.27 |
Chinese 31 | 1000 | 1000 | 0.99 | 0.01 | 0.99 | 0.01 |
DISCUSSION
Genotyping the frequencies of HPA systems is useful in collecting data on the genetics of the population, but may also be useful in clinical scenarios. The allele frequencies of HPA-1 and HPA-5 systems tested in 508 cord blood samples representing the Maltese population were found to be very similar to other Caucasian populations which are geographically close to Malta, such as the Italian, French and German populations (Table 3). When observing the allele frequencies calculated for individuals with one or both parents being foreign, the allele frequencies were also very similar to southern European and northern African populations since most immigrants in Malta originate from these countries.
The incidence rate of FNAIT in several Caucasian populations was found to be 1 in 1000 to 1 in 2000 live births. Last reported data from the National Statistical Office of Malta reported a total of 4444 live births in 2018.37 Since the HPA-1 and HPA-5 allele frequencies in the Maltese population are similar to other European countries, one should expect to observe approximately 2-3 cases of FNAIT per year. The number of cases of FNAIT in Malta are much lower [Dr. Laspina personal communication]. This low local incidence rate of neonates with FNAIT may be due to several reasons including neonates with FNAIT being born healthy and asymptomatic, or because the HPA incompatibility leads to severe complications such as miscarriages. A similarly low frequency of FNAIT was observed in the Irish population, suggested to be due to under-recognition of the condition.38
With the data collected from this study, prospective implementations may be recommended such as donor and patient platelet antigen typing prior to transfusion. Anti-HPA screening is not recommended as this only indicates a possible risk factor for the development of FNAIT and therefore has several ethical issues, including the prediction and management of alloimmunised pregnancies. Post-natal management of FNAIT is therefore more favourable, including setting up genotype screening of newborns showing clinical symptoms requiring transfusion, for appropriate diagnosis and treatment with platelet products. Other possible applications of these findings include using the optimised methods for genotype screening of adults for PTP and RTP, as well as genotyping donor and patient prior to platelet transfusions.38
SUMMARY
- Platelets have different surface antigens which make up the Human Platelet Antigen (HPA) system.
- These different glycoproteins on platelet surfaces contribute to different clinical conditions which include FNAIT, PTP and RTP.
- Each country has different allele frequencies for these HPA systems.
- This study was carried out to determine the allele frequency of two of the most common HPA systems, HPA-1 & HPA-5, in the Maltese population.
- PCR and a restriction enzyme digest were used to genotype 508 random DNA samples.
- The local frequencies of these two HPA systems are: HPA-1a/1a; 71.6%, HPA-1a/1b; 25.5%, HPA-1b/1b; 2.9%, HPA-5a/5a; 77.4%, HPA-5a/5b; 22.0% and HPA-5b/5b; 0.6%.
ACKNOWLEDGEMENTS
Financial support was obtained from a University of Malta research grant held by R. Farrugia.
References
- Curtis BR. Genotyping for human platelet alloantigen polymorphisms: applications in the diagnosis of alloimmune platelet disorders. Sem Thromb Hemost 2008;34:539–548.
- Santoso S, Kiefel V. Human platelet-specific alloantigens: update. Vox Sang 1998;74: 249-253.
- Santoso, S., Kiefel, V., & Mueller-Eckhardt, C. (1989). Immunochemical characterization of the new platelet alloantigen system Bra/Brb. British Journal of Haematology, 72(2), 191-198.
- Peterson, E. T., Sutherland, R., Robinson, D. L., Chasteen, L., Gersh, M., Overhauser, J., . . . Grady, D. L. (1999). An integrated physical map for the short arm of human chromosome 5. Genome Research, 9(12), 1250-1267.
- Santoso, S., Kalb, R., Walka, M., Kiefel, V., Mueller-Eckhardt, C., & Newman, P. (1993). The human platelet alloantigens Br(a) and Brb are associated with a single amino acid polymorphism on glycoprotein Ia (integrin subunit alpha 2). The Journal of Clinical Investigation, 92, 2427-2432.
- Goldberger, A., Kolodziej, M., Poncz, M., Bennett, J. S., & Newman, P. J. (1991). Effect of single amino acid substitutions on the formation of the PlA and Bak alloantigenic epitopes. Blood, 78, 681-687.
- Ensembl [internet]. 2020 [cited November 2020]. Transcript: ITGB3-201. Available from: https://www.ensembl.org/Homo_sapiens/Transcript/Exons?db=core;g=ENSG00000259207;r=17:47253827-47313743;t=ENST00000559488.
- Pavio N, Lai MMC. The hepatitis C virus persistence. How to evade the immune system? J Biosci 2003;28:287–304.
- Muller HM, Pfaff E, Goeser T, Kallinwski B, Solbach C, Thielman L. Peripheral blood leukocytes serve as a possible extra hepatic site for hepatitis C virus replication. J Gen Virol 1995;74:669.
- Pugliese A, Gennero L, Cutufia M, Enrietto M, Morra E, Pescarmona P, Ponzetto A. HCV infective virions can be carried by human platelets. Cell Biochem Funct 2004;22:353–358.
- Verdichio-Moraes CF, Toralles-Pereira C, Grotto RM, Silva GF, Pardini MI. Allelic frequencies of HPA-1 to 5 human platelet antigens in patients infected with hepatitis C virus. Med. Virol. 2009;81:757–759.
- Mueller-Eckhardt C, et al. 348 cases of suspected neonatal alloimmune thrombocytopenia. Lancet 1989;18:363-366.
- Reznikoff-Etievant M, Kaplan C, Muller JY, Daffos F, Forestier F. Alloimmune thrombocytopenias, definition of a group at risk: a prospective study. Current Studies in Haematology and Blood Transfusion 1988;55:119-124.
- Kaplan C, Schlegel N, Durand-Zaleski I, Tchernia G, Blum-Boisgard C. Anti-HPA-la materno-fetal platelet alloimmunisation: costs and benefits of a prospective routine program. Thrombosis and Hamostasis 1993;69:191.
- Blanchette VS, Chen L, de Friedberg ZS, Hogan VA, Trudel E, Decary F. Alloimmunization to the PIA1 platelet antigen: results of a prospective study. British journal of Haematology 1990;72:209-215.
- Petermann R, Bakchoul T, Curtis BR, Mullier F, Miyata S, Arnold DM. Investigations for fetal and neonatal alloimmune thrombocytopenia: communication from the SSC of the ISTH. J Thromb and Haemost 2018;16:2526–2529.
- McCrae K R, Samuels P, Schreiber AD.Pregnancy-Associated Thrombocytopenia: Pathogenesis and Management. Blood 1992;80:2697-271.
- Cohen DL, Baglin TP. Assessment and management of immune thrombocytopenia in pregnancy and in neonates. Arch Dis Child 1995;72:71-76.
- Kaplan C. Neonatal alloimmune thrombocytopenia. Haematologica 2008;93:805- 807.
- Kaplan C, et al. HPA-5b (Br(a)) neonatal alloimmune thrombocytopenia: clinical and immunological analysis of 39 cases. Br J Haematol 1991;78:425-429.
- Murata M, Furihata K, Ishida F, Russell SR, Ware J, Ruggeri ZM. Genetic and structural characterization of an amino acid dimorphism in glycoprotein Ib alpha involved in platelet transfusion refractoriness. Blood 1992;79:3086–3090.
- Padhi P, et al.Post-transfusion purpura: a rare and life-threatening aetiology of thrombocytopenia. BMJ Case Rep. 2013; 2013:brc2013008860.
- Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215.
- Newman PJ, Derbes RS, Aster RH. The Human Platelet Alloantigens, PlA1and PlA2 Are Associated with a Leucine33/Proline33 Amino Acid Polymorphism in MembraneGlycoprotein Ilia, and Are Distinguishable by DNA Typing. J Clin Invest 1989;83:1778-1781.
- Liu TC, Shih MC, Lin CL, Lin SF, Chen CM, Chang JG. Gene frequencies of the HPA-1 to HPA-8w platelet antigen alleles in Taiwanese, Indonesian, and Thai. Ann Hematol 2002;81:244-248.
- EMBL-EBI [internet]. 2020 [cited May 2020]. Immuno Polymorphism Database: HPA Allele Frequencies. Available from: http://www.ebi.ac.uk/ipd/hpa/freqs_1.html.
- Mojaat N, et al. Gene frequencies of human platelet antigens in the Tunisian population. Tissue Antigens 1999;54:201-204.
- Ferrer G, et al. Analysis of human platelet antigen systems in a Moroccan Berber population. Transfus Med 2002;12:49-54.
- Rozman P, Drabbels J, Schipper RF, Doxiadis I, Stein S, Claas FH. Genotyping for human platelet-specific antigens HPA-1, -2, -3, -4 and -5 in the Slovenian population reveals a slightly increased frequency of HPA-1b and HPA-2b as compared to other European populations. J. Immunogen. 1999;26:265-269.
- Boehlen F, Bulla O, Michel M, Reber G, de Moerloose P. HPA-genotyping and antiplatelet antibodies in female blood donors. The Hematology Journal 2003;4:441-444.
- Muñiz-Díaz E, Arilla M, Ibáñez M, Bosch MA, Pastoret C, Madoz P. Frequency of platelet alloantigens in the Spanish population. Sangre 1993:38; 289-293.
- Steffensen R, Kaczan E, Varming K, Jersild C. Frequency of platelet-specific alloantigens in a Danish population. Tissue Antigens 1996;48:93-96.
- Carlsson LE, Greinacher A, Spitzer C, Walther R, Kessler C. Polymorphisms of the Human Platelet Antigens HPA-1, HPA-2, HPA-3, and HPA-5 on the Platelet Receptors for Fibrinogen (GPIIb/IIIa), von Willebrand Factor (GPIb/IX), and Collagen (GPIa/IIa) Are Not Correlated With an Increased Risk for Stroke. Stroke 1997;28:1392-1395.
- National Library of Medicine [internet]. 2020[cited May 2020]. dbSNP. Available from: https://www.ncbi.nlm.nih.gov/snp/rs5918#frequency_tab.
- Halle L, et al. HPA polymorphism in sub-Saharan African populations: Beninese, Cameroonians, Congolese, and Pygmies. Tissue Antigens 2005;65:295-298.
- Feng ML, et al. Establishment of an HPA-1- to -16-typed platelet donor registry in China. Transfus Med 2006;16:369-374.
- Population, Migration and Crime Statistics Unit, National Statistics Office [internet]. 2019 [cited July 2020]. News Release; World Population Day: 2019. Available from: https://nso.gov.mt/en/News_Releases/View_by_Unit/Unit_C5/Population_and_Migration_Statistics/Documents/2019/News2019_108.pdf.
- Davoren A, McParland P, Barnes CA, Murphy WG. Neonatal alloimmune thrombocytopenia in the Irish population: a discrepancy between observed and expected cases. Clin. Pathol. 2002; 55:289-292.
Figure
Test image
License
The Editorial Board retains the copyright of all material published in the Malta Medical Journal. Any reprint in any form of any part will require permission from the Editorial Board. Material submitted to the Editorial Board will not be returned, unless specifically requested.